Thermal Stability and Crystallization Processes of Pd78Au4Si18 Thin Films Visualized via In Situ TEM.

Amorphous alloys or metallic glasses (MGs) thin films have attracted extensive attention in various fields due to their unique functional properties. Here, we use in situ heating transmission electron microscopy (TEM) to investigate the thermal stability and crystallization behavior of Pd-Au-Si thin films prepared by a pulsed laser deposition (PLD) method. Upon heating treatment inside a TEM, we trace the structural changes in the Pd-Au-Si thin films through directly recording high-resolution images and diffraction patterns at different temperatures. TEM observations reveal that the Pd-Au-Si thin films started to nucleate with small crystalline embryos uniformly distributed in the glassy matrix upon approaching the glass transition temperature Tg=625K, and subsequently, the growth of crystalline nuclei into sub-10 nm Pd-Si nanocrystals commenced. Upon further increasing the temperature to 673K, the thin films transformed to micro-sized patches of stacking-faulty lamellae that further crystallized into Pd9Si2 and Pd3Si intermetallic compounds. Interestingly, with prolonged thermal heating at elevated temperatures, the Pd9Si2 transformed to Pd3Si. Simultaneously, the solute Au atoms initially dissolved in glassy alloys and eventually precipitated out of the Pd9Si2 and Pd3Si intermetallics, forming nearly spherical Au nanocrystals. Our TEM results reveal the unique thermal stability and crystallization processes of the PLD-prepared Pd-Au-Si thin films as well as demonstrate a possibility of producing a large quantity of pure nanocrystals out of amorphous solids for various applications.

HWJMSC-EVs promote cartilage regeneration and repair via the ITGB1/TGF-ß/Smad2/3 axis mediated by microfractures.

The current first-line treatment for repairing cartilage defects in clinical practice is the creation of microfractures (MF) to stimulate the release of mesenchymal stem cells (MSCs); however, this method has many limitations. Recent studies have found that MSC-derived extracellular vesicles (MSC-EVs) play an important role in tissue regeneration. This study aimed to verify whether MSC-EVs promote cartilage damage repair mediated by MFs and to explore the repair mechanisms. In vitro experiments showed that human umbilical cord Wharton's jelly MSC-EVs (hWJMSC-EVs) promoted the vitality of chondrocytes and the proliferation and differentiation ability of bone marrow-derived MSCs. This was mainly because hWJMSC-EVs carry integrin beta-1 (ITGB1), and cartilage and bone marrow-derived MSCs overexpress ITGB1 after absorbing EVs, thereby activating the transforming growth factor-ß/Smad2/3 axis. In a rabbit knee joint model of osteochondral defect repair, the injection of different concentrations of hWJMSC-EVs into the joint cavity showed that a concentration of 50 µg/ml significantly improved the formation of transparent cartilage after MF surgery. Extraction of regenerated cartilage revealed that the changes in ITGB1, transforming growth factor-ß, and Smad2/3 were directly proportional to the repair of regenerated cartilage. In summary, this study showed that hWJMSC-EVs promoted cartilage repair after MF surgery.

Control of the spider-like interference structure in photoelectron momentum distributions of a helium atom in a few-cycle nonlinear chirped laser pulse.

We investigate theoretically the photoelectron momentum distributions (PMDs) of the helium atom in the few-cycle nonlinear chirped laser pulse. The numerical results show that the direction of the spider-like interference structure in PMDs exhibits periodic variations with the increase of the chirp parameter. It is illustrated that the direction of the spider-like interference structure is related to the direction of the electron motion by tracking the trajectories of the electrons. We also demonstrate that the carrier-envelope phase can precisely control the opening of the ionization channel. In addition, we investigate the PMDs when a chirp-free second harmonic (SH) laser pulse is added to the chirped laser field, the numerical results show that the interference patterns can change from only spider-like interference structure to both spider-like and ring-like interference structures.

Spontaneous Skyrmion Bubbles in an Iron-Silicon Alloy with Uniaxial Magnetic Anisotropy.

The magnetic skyrmions exhibit intriguing topological behaviors, holding promise for future applications in the realm of spintronic devices. Despite recent advancements, achieving spontaneous magnetic skyrmions and topological transitions in magnets featuring uniaxial magnetic anisotropy, particularly at elevated temperatures (>100 K), remains a challenging endeavor. Here, single-crystal Fe5Si3 nanorods with the central symmetry and uniaxial magnetic anisotropy were successfully synthesized on a mica substrate through chemical vapor deposition, which exhibit a high Curie temperature (TC) of about 372 K. The real-time observation, facilitated by Lorentz transmission electron microscopy, revealed the spontaneous formation of magnetic skyrmions and evolution of domains in focused ion beam-prepared Fe5Si3 thin foils. Moreover, Fe5Si3 device transport measurements expose notable magnetoresistance (MR) effects, enabling the interchange between positive and negative MR across specific temperature settings. These results offer various potential avenues for exploring diverse topological spin textures and their formation mechanisms, indicating inventive applications for iron-silicon alloy in the realm of spintronics.

Observation of Topological Hall Effect in a Chemically Complex Alloy.

The topological Hall effect (THE) is the transport response of chiral spin textures and thus can serve as a powerful probe for detecting and understanding these unconventional magnetic orders. So far, the THE is only observed in either noncentrosymmetric systems where spin chirality is stabilized by Dzyaloshinskii-Moriya interactions, or triangular-lattice magnets with Ruderman-Kittel-Kasuya-Yosida-type interactions. Here, a pronounced THE is observed in a Fe-Co-Ni-Mn chemically complex alloy with a simple face-centered cubic (fcc) structure across a wide range of temperatures and magnetic fields. The alloy is shown to have a strong magnetic frustration owing to the random occupation of magnetic atoms on the close-packed fcc lattice and the direct Heisenberg exchange interaction among atoms, as evidenced by the appearance of a reentrant spin glass state in the low-temperature regime and the first principles calculations. Consequently, THE is attributed to the nonvanishing spin chirality created by strong spin frustration under the external magnetic field, which is distinct from the mechanism responsible for the skyrmion systems, as well as geometrically frustrated magnets.

Application and challenges of stem cells in cardiovascular aging.

With the rapid development of society and the economy, population aging has become a common challenge faced by many countries in the world today. Structural and functional changes in the cardiovascular system can occur with age, increasing the incidence and severity of cardiovascular diseases in older adults. Due to the limited regenerative capacity of myocardial cells, myocardial infarction and its resulting heart failure and congenital heart disease have become the number one killer of human health. At present, the treatment of cardiovascular diseases includes drug therapy and nondrug therapy. Nondrug therapy mainly includes minimally invasive interventional therapy, surgical diagnosis and treatment, and cell therapy. Long-term drug treatment may cause headache due to vasodilation, lower blood pressure, digestive system dysfunction and other side effects. Surgical treatment is traumatic, difficult to treat, and expensive. In recent years, stem cell therapy has exhibited broad application prospects in basic and clinical research on cardiovascular disease because of its plasticity, self-renewal and multidirectional differentiation potential. Therefore, this paper looks at stem cell therapy for diseases, reviews recent advances in the mechanism and clinical transformation of cardiovascular aging and related diseases in China, and briefly discusses the development trend and future prospects of cardiovascular aging research.

Engineered extracellular vesicles (EVs): Promising diagnostic/therapeutic tools for pediatric high-grade glioma.

Diffuse intrinsic pontine glioma (DIPG) is a highly malignant brain tumor that mainly occurs in children with extremely low overall survival. Traditional therapeutic strategies, such as surgical resection and chemotherapy, are not feasible mostly due to the special location and highly diffused features. Radiotherapy turns out to be the standard treatment method but with limited benefits of overall survival. A broad search for novel and targeted therapies is in the progress of both preclinical investigations and clinical trials. Extracellular vesicles (EVs) emerged as a promising diagnostic and therapeutic candidate due to their distinct biocompatibility, excellent cargo-loading-delivery capacity, high biological barrier penetration efficiency, and ease of modification. The utilization of EVs in various diseases as biomarker diagnoses or therapeutic agents is revolutionizing modern medical research and practice. In this review, we will briefly talk about the research development of DIPG, and present a detailed description of EVs in medical applications, with a discussion on the application of engineered peptides on EVs. The possibility of applying EVs as a diagnostic tool and drug delivery system in DIPG is also discussed.

Increased Expression of Pluripotent Factors in Human Umbilical Cord Mesenchymal Stem Cells Transfected with Three tRF Molecules.

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.

The hypoxia-related signature predicts prognosis, pyroptosis and drug sensitivity of osteosarcoma.

Osteosarcoma (OS) is one of the most common types of solid sarcoma with a poor prognosis. Solid tumors are often exposed to hypoxic conditions, while hypoxia is regarded as a driving force in tumor recurrence, metastasis, progression, low chemosensitivity and poor prognosis. Pytoptosis is a gasdermin-mediated inflammatory cell death that plays an essential role in host defense against tumorigenesis. However, few studies have reported relationships among hypoxia, pyroptosis, tumor immune microenvironment, chemosensitivity, and prognosis in OS. In this study, gene and clinical data from Therapeutically Applicable Research to Generate Effective Treatments (TARGET) and Gene Expression Omnibus (GEO) databases were merged to develop a hypoxia risk model comprising four genes (PDK1, LOX, DCN, and HMOX1). The high hypoxia risk group had a poor prognosis and immunosuppressive status. Meanwhile, the infiltration of CD8+ T cells, activated memory CD4+ T cells, and related chemokines and genes were associated with clinical survival outcomes or chemosensitivity, the possible crucial driving forces of the OS hypoxia immune microenvironment that affect the development of pyroptosis. We established a pyroptosis risk model based on 14 pyroptosis-related genes to independently predict not only the prognosis but also the chemotherapy sensitivities. By exploring the various connections between the hypoxic immune microenvironment and pyroptosis, this study indicates that hypoxia could influence tumor immune microenvironment (TIM) remodeling and promote pyroptosis leading to poor prognosis and low chemosensitivity.

An inflammatory response-related gene signature associated with immune status and prognosis of acute myeloid leukemia.

OBJECTIVE: To determine the prognostic significance of inflammatory response-associated genes in acute myeloid leukemia (AML). METHODS: Transcriptomic profiles and related clinical information of AML patients were acquired from a public database. To establish a multi-gene prognosis signature, we performed least absolute shrinkage and selection operator Cox analysis for the TCGA cohort and evaluated the ICGC cohort for verification. Subsequently, Kaplan-Meier analysis was carried out to compare the overall survival (OS) rates between high- and low-risk groups. Biological function and single-sample gene set enrichment (ssGSEA) analyses were employed to investigate the association of risk score with immune status and the tumor microenvironment. Prognostic gene expression levels in AML samples and normal controls were confirmed by qRT-PCR and immunofluorescence. RESULTS: We identified a potential inflammatory response-related signature comprising 11 differentially expressed genes, including ACVR2A, CCL22, EBI3, EDN1, FFAR2, HRH1, ICOSLG, IL-10, INHBA, ITGB3, and LAMP3, and found that AML patients with high expression levels in the high-risk group had poor OS rates. Biological function analyses revealed that prognostic genes mainly participated in inflammation and immunity signaling pathways. Analyses of cancer-infiltrating immunocytes indicated that in high-risk patients, the immune suppressive microenvironment was significantly affected. The expression of the inflammation reaction-associated signature was found to be associated with susceptibility to chemotherapy. There was a significant difference in prognostic gene expression between AML and control tissues. CONCLUSION: A novel inflammatory response-related signature was developed with 11 candidate genes to predict prognosis and immune status in AML patients.

Comprehensive Analysis of Sterol O-Acyltransferase 1 as a Prognostic Biomarker and Its Association With Immune Infiltration in Glioma.

Metabolic reprogramming is a hallmark of glioma, and sterol O-acyltransferase 1 (SOAT1) is an essential target for metabolic therapy. However, the prognostic value of SOAT1 and its association with immune infiltration has not been fully elucidated. Using RNA-seq and clinical data of glioma patients from The Cancer Genome Atlas (TCGA), SOAT1 was found to be correlated with poor prognosis in glioma and the advanced malignancy of clinicopathological characteristics. Next, the correlation between SOAT1 expression and tumor-infiltrating immune cells was performed using the single-sample GSEA algorithm, gene expression profiling interactive analysis (GEPIA), and tumor immune estimation resource version 2 (TIMER2.0); it was found that SOAT1 expression was positively correlated with multiple tumor-infiltrating immune cells. To further verify these results, immunofluorescence was conducted on paraffin-embedded glioma specimens, and a positive trend of the correlation between SOAT1 expression and Treg infiltration was observed in this cohort. Finally, differentially expressed gene analysis, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses were performed to explore the biological processes and signaling pathways that SOAT1 may be involved in during glioma pathogenesis. A protein-protein interaction network was established, and co-expression analysis was conducted to investigate the regulatory mechanism of SOAT1 in glioma. To the best of our knowledge, this is the first comprehensive study reporting that SOAT1 may serve as a novel prognostic biomarker associated with immune infiltrates, providing a novel perspective for glioma metabolic therapy.

Cholesterol metabolism and its implication in glioblastoma therapy.

Glioblastoma (GBM) is the most lethal malignant tumor in the central nervous system, with a median survival of only 14 months. Cholesterol, which is the main component of cell membrane and the precursor of many hormones, is one of the most important lipid components in human body. Since reprogramming of the cholesterol metabolic profile has been discovered in many cancers including GBM, cholesterol metabolism becomes a promising potential target for therapy. Since GBM cells rely on external cholesterol to survive and accumulate lipid droplets to meet their rapid growth needs, targeting the metabolism of cholesterol by different strategies including inhibition of cholesterol uptake and promotion of cholesterol efflux by activating LXRs and disruption of cellular cholesterol trafficking, inhibition of SREBP signaling, inhibition of cholesterol esterification, could potentially oppose the growth of glial tumors. In this review, we discussed the above findings and describe cholesterol synthesis and homeostatic feedback pathways in normal brain tissues and brain tumors, statin use in GBM and the role of lipid rafts and cholesterol precursors and oxysterols in the treatment and pathogenesis of GBM are also summarized.

SOCS proteins and their roles in the development of glioblastoma.

Glioblastoma multiforme (GBM) is the most common type of primary brain tumor in adults. GBM is characterized by a high degree of malignancy and aggressiveness, as well as high morbidity and mortality rates. GBM is currently treatable via surgical resection, chemotherapy and radiotherapy, but the prognosis of patients with GBM is poor. The suppressor of cytokine signaling (SOCS) protein family comprises eight members, including SOCS1-SOCS7 and cytokine-inducible SH2-containing protein. SOCS proteins regulate the biogenesis of GBM via the JAK/STAT and NF-κB signaling pathways. Driven by NF-κB, the expression of SOCS proteins can serve as a negative regulator of the JAK/STAT signaling pathway and exerts a potential inhibitory effect on GBM. In GBM, E3 ubiquitin ligase is involved in the regulation of cellular functions, such as the receptor tyrosine kinase (RTK) survival signal, in which SOCS proteins negatively regulate RTK signaling, and kinase overexpression or mutation can lead to the development of malignancies. Moreover, SOCS proteins affect the proliferation and differentiation of GBM cells by regulating the tumor microenvironment. SOCS proteins also serve specific roles in GBM of different grades and different isocitrate dehydrogenase mutation status. The aim of the present review was to describe the biogenesis and function of the SOCS protein family, the roles of SOCS proteins in the microenvironment of GBM, as well as the role of this protein family and E3 ubiquitin ligases in GBM. Furthermore, the role of SOCS proteins as diagnostic and prognostic markers in GBM and their potential role as GBM therapeutics were explored.

The role of ubiquitin-specific peptidases in glioma progression.

The balance between ubiquitination and deubiquitination is crucial for protein stability, function and location under physiological conditions. Dysregulation of E1/E2/E3 ligases or deubiquitinases (DUBs) results in malfunction of the ubiquitin system and is involved in many diseases. Increasing reports have indicated that ubiquitin-specific peptidases (USPs) play a part in the progression of many kinds of cancers and could be good targets for anticancer treatment. Glioma is the most common malignant tumor in the central nervous system. Clinical treatment for high-grade glioma is unsatisfactory thus far. Multiple USPs are dysregulated in glioma and have the potential to be therapeutic targets. In this review, we collected studies on the roles of USPs in glioma progression and summarized the mechanisms of USPs in glioma tumorigenesis, malignancy and chemoradiotherapy resistance.

Nanoscale Visualization of a Photoinduced Plasmonic Near-Field in a Single Nanowire by Free Electrons.

Swift electrons can undergo inelastic interactions not only with electrons but also with near-fields, which may result in an energy loss or gain. Developments in photon-induced near-field electron microscopy (PINEM) enable direct imaging of the plasmon near-field distribution with nanometer resolution. Here, we report an analysis of the surface plasmonic near-field structure based on PINEM observations of silver nanowires. Single-photon order-selected electron images revealed the wavelike and banded structure of electric equipotential regions for a confined near-field integral associated with typical absorption of photon quanta (nℏω). Multimodal plasmon oscillations and second-harmonic generation were simultaneously observed, and the polarization dependence of plasmon wavelength and symmetry properties were analyzed. Based on advanced imaging techniques, our work has implications for future studies of the localized-field structures at interfaces and visualization of novel phenomena in nanostructures, nanosensors, and plasmonic devices.

Emerging roles of suppressor of cytokine signaling 3 in human cancers.

As a member of the suppressor of cytokine signaling (SOCS) family, SOCS3 is a cytokine-inducible protein that inhibits cytokine signaling in a variety of signaling pathways. Increasing evidence shows that SOCS3 regulates tumor development through multiple pathological and physiological processes. It is worth mentioning that SOCS3 negatively regulates JAK/STAT signaling by binding to JAK/cytokine receptors or phosphorylation docking sites on STAT receptors, thus preventing tumor cell proliferation and inhibiting tumor cell invasion and metastasis. The kinase inhibitory region KIR of SOCS3 is the key to JAK inhibition. In addition, SOCS3 may also regulate tumor progression through other molecules or signaling pathways, such as microRNAs (miRNAs), IL-6 and NF-κB signaling pathway. MicroRNAs inhibit SOCS3 expression by binding to the 3' untranslated region of SOCS3 mRNA, thus regulating tumor development processes, including tumor cell proliferation, invasion, metastasis, differentiation, cell cycle and apoptosis, as well as tumor metastasis and chemotherapy resistance. On the whole, SOCS3 acts as an inhibitor of the majority of tumors through various pathways. In the present review, the role of SOCS3 in multitudinous tumors was comprehensively summarized, the molecular mechanisms and modes of action of SOCS3 in tumors were discussed, and the association between SOCS3 expression and the clinical characteristics of patients with cancer were emphasized.

UnitCell Tools, a package to determine unit-cell parameters from a single electron diffraction pattern.

Electron diffraction techniques in transmission electron microscopy (TEM) have been successfully employed for determining the unit-cell parameters of crystal phases, albeit they exhibit a limited accuracy compared with X-ray or neutron diffraction, and they often involve a tedious measurement procedure. Here, a new package for determining unit-cell parameters from a single electron diffraction pattern has been developed. The essence of the package is to reconstruct a 3D reciprocal primitive cell from a single electron diffraction pattern containing both zero-order Laue zone and high-order Laue zone reflections. Subsequently, the primitive cell can be reduced to the Niggli cell which, in turn, can be converted into the unit cell. Using both simulated and experimental patterns, we detail the working procedure and address some effects of experimental conditions (diffraction distortions, misorientation of the zone axis and the use of high-index zone axis) on the robustness and accuracy of the software developed. The feasibility of unit-cell determination of the TiO2 nanorod using this package is also demonstrated. Should the parallel-beam, nano-beam and convergent-beam modes of the TEM be used flexibly, the software can determine unit-cell parameters of unknown-structure crystallites (typically >50 nm).

SLC7A11 negatively associates with mismatch repair gene expression and endows glioblastoma cells sensitive to radiation under low glucose conditions.

The cystine/glutamate antiporter xCT (SLC7A11) is frequently upregulated in many cancers, including glioblastoma (GBM). SLC7A11-mediated cystine taken up is reduced to cysteine, a precursor amino acid for glutathione synthesis and antioxidant cellular defense. However, little is known about the biological functions of SLC7A11 and its effect on therapeutic response in GBM. Here, we report that the expression of SLC7A11 is higher in GBM compared with normal brain tissue, but is negatively associated with tumor grades and positively impacts survival in the bioinformatic analysis of TCGA and CGGA database. Additionally, a negative association between SLC7A11 and mismatch repair (MMR) gene expression was identified by Pearson correlation analysis. In the GBM cells with glucose-limited culture conditions, overexpression of SLC7A11 significantly decreased MMR gene expression, including MLH1, MSH6, and EXO1. SLC7A11-overexpressed GBM cells demonstrated elevated double-strand break (DSB) levels and increased sensitivity to radiation treatment. Taken together, our work indicates that SLC7A11 might be a potential biomarker for predicting a better response to radiotherapy in GBM.

Cullin-5 (CUL5) as a potential prognostic marker in a pan-cancer analysis of human tumors.

There is some evidence supporting an association between Cullin-5 (CUL5) and cancer, but no research using pan-cancer analysis has been conducted previously. We therefore investigated the oncogenic role of CUL5 in 33 tumors from the Gene Expression Omnibus and The Cancer Genome Atlas databases. Many cancers reduce CUL5 levels, and the prognosis of certain cancers is vitally linked with CUL5 expression. CUL5 expression is associated with CD8 + T-cell infiltration levels in uveal melanomas and head and neck squamous cell carcinomas, and we observed a positive relationship between CUL5 and Tcm (T central memory) cells, and a negative relationship between T helper (Th) cells and pDC (plasmacytoid DC). CUL5 had negative associations with NK cells, NK CD56bright cells, NK CD56dim cells, Tregs, cytotoxic cells, and Th17 cells. Functions relating to protein processing and ubiquitin were included in the CUL5 functional mechanisms. The top 100 genes that are most strongly related to CUL5 were identified, and enrichment analysis indicated that the biological process with the closest relationship was neddylation, related pathways included the TGF-beta signaling pathway and intracellular receptor signaling pathway. CUL5 is related to biological cell behaviors such as chromosome segregation and positive regulation of chromosome organization. As the first study to perform a pan-cancer analysis of CUL5, the present findings will improve the understanding of the oncogenic role of CUL5 in different tumors.

Establishment of a Systemic Inflammatory Response Syndrome Model and Evaluation of the Efficacy of Umbilical Cord Mesenchymal Stem Cell Transplantation.

Based on the characteristics of modern weapon injury, a repetitive model of traumatic systemic inflammatory response syndrome (SIRS) and an evaluation system were established. The models were treated with GFP-labeled tree shrew umbilical cord mesenchymal stem cells (UCMSCs). Forty out of 50 tree shrews were used to make a unilateral femoral comminuted fracture. Lipopolysaccharide was injected intravenously to create a traumatic SIRS model. The other 10 shrews were used as normal controls. After the model was established for 10 days, 20 tree shrews were injected intravenously with GFP-labeled UCMSCs, and 18 tree shrews were not injected as the model control group. The distribution of GFP-labeled cells in vivo was measured at 2 and 10 days after injection. Twenty days after treatment, the model group, the normal control group, and the treatment group were taken to observe the pathological changes in each tissue, and blood samples were taken for the changes in liver, renal, and heart function. Distribution of GFP-positive cells was observed in all tissues at 2 and 10 days after injection. After treatment, the HE staining results of the treatment group were close to those of the normal group, and the model group had a certain degree of lesions. The results of liver, renal, and heart function tests in the treatment group were returned to normal, and the results in the model group were abnormally increased. UCMSCs have a certain effect on the treatment of traumatic SIRS and provide a new technical solution for modern weapon trauma treatment.